scramble sirnas Search Results


fluorescence-labelled control, scrambled and human p140cap-specific sirnas (aagctgtgtctgttgaggctg)  (Xeragon Inc)
90
Xeragon Inc fluorescence-labelled control, scrambled and human p140cap-specific sirnas (aagctgtgtctgttgaggctg)
Fluorescence Labelled Control, Scrambled And Human P140cap Specific Sirnas (Aagctgtgtctgttgaggctg), supplied by Xeragon Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/scramble+sirnas/pmc01894765-362-7-9?v=Xeragon+Inc
Average 90 stars, based on 1 article reviews
fluorescence-labelled control, scrambled and human p140cap-specific sirnas (aagctgtgtctgttgaggctg) - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier
sirna for sp1 or ctcf and scramble sirna  (Shanghai GenePharma)
90
Shanghai GenePharma sirna for sp1 or ctcf and scramble sirna
Sirna For Sp1 Or Ctcf And Scramble Sirna, supplied by Shanghai GenePharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/scramble+sirnas/10__1161_slash_atvbaha__114__303899-151-7-14?v=Shanghai+GenePharma
Average 90 stars, based on 1 article reviews
sirna for sp1 or ctcf and scramble sirna - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier
scrambled negative control sirna  (Ribobio co)
90
Ribobio co scrambled negative control sirna
Scrambled Negative Control Sirna, supplied by Ribobio co, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/scramble+sirnas/pm40643013-111-9-14?v=Ribobio+co
Average 90 stars, based on 1 article reviews
scrambled negative control sirna - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier
sirna of arg2, ho-1, creb1 and their matched scramble control  (Ribobio co)
90
Ribobio co sirna of arg2, ho-1, creb1 and their matched scramble control
Sirna Of Arg2, Ho 1, Creb1 And Their Matched Scramble Control, supplied by Ribobio co, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/scramble+sirnas/pm37856999-80-4-14?v=Ribobio+co
Average 90 stars, based on 1 article reviews
sirna of arg2, ho-1, creb1 and their matched scramble control - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier
scrambled or zap sirnas  (Ribobio co)
90
Ribobio co scrambled or zap sirnas
Scrambled Or Zap Sirnas, supplied by Ribobio co, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/scramble+sirnas/pmc04210284-297-8-10?v=Ribobio+co
Average 90 stars, based on 1 article reviews
scrambled or zap sirnas - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier
scrambled sirna  (Shanghai GenePharma)
90
Shanghai GenePharma scrambled sirna
Scrambled Sirna, supplied by Shanghai GenePharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/scramble+sirnas/pm28713900-39-7-10?v=Shanghai+GenePharma
Average 90 stars, based on 1 article reviews
scrambled sirna - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier
6-carboxyfluorescein-tagged, negative control (nc) scrambled sirnas  (Shanghai GenePharma)
90
Shanghai GenePharma 6-carboxyfluorescein-tagged, negative control (nc) scrambled sirnas
6 Carboxyfluorescein Tagged, Negative Control (Nc) Scrambled Sirnas, supplied by Shanghai GenePharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/scramble+sirnas/pm28693266-37-6-22?v=Shanghai+GenePharma
Average 90 stars, based on 1 article reviews
6-carboxyfluorescein-tagged, negative control (nc) scrambled sirnas - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier
scramble sirna  (Shanghai GenePharma)
90
Shanghai GenePharma scramble sirna
Scramble Sirna, supplied by Shanghai GenePharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/scramble+sirnas/pm27862321-67-5-7?v=Shanghai+GenePharma
Average 90 stars, based on 1 article reviews
scramble sirna - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier
scrambled control sirna  (Shanghai GenePharma)
90
Shanghai GenePharma scrambled control sirna
Scrambled Control Sirna, supplied by Shanghai GenePharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/scramble+sirnas/pm24938684-52-4-11?v=Shanghai+GenePharma
Average 90 stars, based on 1 article reviews
scrambled control sirna - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier
negative scrambled sirna  (Shanghai GenePharma)
90
Shanghai GenePharma negative scrambled sirna
The <t> siRNA </t> sequences used in RNA interference analysis.
Negative Scrambled Sirna, supplied by Shanghai GenePharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/scramble+sirnas/pmc05985735-154-13-21?v=Shanghai+GenePharma
Average 90 stars, based on 1 article reviews
negative scrambled sirna - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier
negative control sirna scrambled sequence  (Shanghai GenePharma)
90
Shanghai GenePharma negative control sirna scrambled sequence
The <t> siRNA </t> sequences used in RNA interference analysis.
Negative Control Sirna Scrambled Sequence, supplied by Shanghai GenePharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/scramble+sirnas/10__1186_slash_1556___276x___9___587-40-7-20?v=Shanghai+GenePharma
Average 90 stars, based on 1 article reviews
negative control sirna scrambled sequence - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier
scrambled control sirna  (Ribobio co)
90
Ribobio co scrambled control sirna
The <t> siRNA </t> sequences used in RNA interference analysis.
Scrambled Control Sirna, supplied by Ribobio co, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/scramble+sirnas/pmc06197781-221-9-15?v=Ribobio+co
Average 90 stars, based on 1 article reviews
scrambled control sirna - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

Image Search Results


The siRNA sequences used in RNA interference analysis.

Journal: Frontiers in Pharmacology

Article Title: DNA Methylation of PTGIS Enhances Hepatic Stellate Cells Activation and Liver Fibrogenesis

doi: 10.3389/fphar.2018.00553

Figure Lengend Snippet: The siRNA sequences used in RNA interference analysis.

Article Snippet: Small interfering RNA (siRNA) oligonucleotides used for knockdown gene and a negative scrambled siRNA was used in parallel were synthesized by GenePharma (Shanghai, China).

Techniques: Negative Control